TOTO HARYANTO

Sedikit goresan menebar manfaat …..

Download


This page is available free software, ebook  and papers that can be downloaded.

>SEQUENCE_0_length_35
GGATATAGGGCCAACCCAACTCAACGGCCTGTCTT
>SEQUENCE_1_length_35
CGACGAATGACAGGTCACGAATTTGGCGGGGATTA
>SEQUENCE_2_length_35
CCAAATAGGTCCTTACATCATGAGACGGGCCAAAT
>SEQUENCE_3_length_35
CGAGATGTATACCTCTAACACTGTGTTCCAAGTAC
>SEQUENCE_4_length_35
AAGCTCCCGCAATGGATCTTGTGACGGGCTGCTCG

Data untuk Aplikasi MEGAN

simpan dalam file : contoh_dna.fasta

>M00982:4:000000000-A64YT:1:1101:15286:1655
TACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA
>M00982:4:000000000-A64YT:1:1101:15945:1658
TACTACAAGGGAATCTAATCCTGTTTTCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAGTCTCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA
>M00982:4:000000000-A64YT:1:1101:16761:1661
TACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA
>M00982:4:000000000-A64YT:1:1101:14230:1664
GACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAATTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA
>M00982:4:000000000-A64YT:1:1101:14032:1668
TACTACTCGTGTATCTAATCCTGTTTTCTCCCCACGCTTTCTCTCCTCATTGTCAGTTACATGCCAGAAATCCGCCTTCTCCACTGGTTTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA
>M00982:4:000000000-A64YT:1:1101:13546:1669
TTCTACAGGGGATCTAATCCTGTTTTCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCACT
>M00982:4:000000000-A64YT:1:1101:18383:1674
TACTACAAGGGTATCTAATCCTGTTTTCTCCCCATGCTTTCGTACCTCAGCGTCAGTATTAGGCCAGATGGCTGCCTTCGCCATCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCATCCTCTCCCATA
>M00982:4:000000000-A64YT:1:1101:14703:1684
TACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA
>M00982:4:000000000-A64YT:1:1101:17050:1695
TACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCTCCTCAGTGTCAGTTACAGGCCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA
>M00982:4:000000000-A64YT:1:1101:16580:1697
GACTACACGGGTATCTAATCCTGTTTTCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA
>M00982:4:000000000-A64YT:1:1101:16738:1698
GACTACTAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA
>M00982:4:000000000-A64YT:1:1101:14711:1701
TACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATACCACTTTCCTCTCCTGCA

 

Hopefully useful…

 

 

Wasalam

 


Leave a Reply

XHTML: You can use these tags: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>